puromycin selection cassette (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
puromycin selection cassette
Puromycin Selection Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6093 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+selection+cassette/lentiCRISPR+v2+(Plasmid+%2352961)/bio_rxiv__64898__2026__03__27__714809-166-38-41
Average 96 stars, based on 6093 article reviews
Puromycin Selection Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6093 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/puromycin+selection+cassette/lentiCRISPR+v2+(Plasmid+%2352961)/bio_rxiv__64898__2026__03__27__714809-166-38-41
Average 96 stars, based on 6093 article reviews
puromycin selection cassette - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Selection:Article Title: Mouse neural tube organoids self-organize floorplate through BMP-mediated cluster competition. Article Snippet: Primary antibodies used: rabbit anti-FOXA2 (Cell Signalling Technologies, #8186S, 1:1000), andmouse anti-ß-tubulin (MPI-CBG antibody facility, 1:200), HRPconjugated secondary antibodies used: Invitrogen Goat anti-Rabbit/Mouse 1:2000. .. H2A-mCherry was integrated into the Rosa26 safe harbour locus of FOXA2-Venus cell line.We first obtained aRosa26 targeting vector with Article Title: Clonal neural tube organoids self-organise floorplate through BMP-mediated cluster competition Article Snippet: .. We first obtained a Rosa26 targeting vector with Article Title: Identification of X-chromosomal genes that drive sex differences in embryonic stem cells through a hierarchical CRISPR screening approach. Article Snippet: Cells were selected with puromycin (1 ng/μl, Sigma) for 3 days, starting at day 2 after transfection. .. The Article Title: The MEMIC is an ex vivo system to model the complexity of the tumor microenvironment Article Snippet: To create a hypoxia reporter for live imaging, an existing GFP-based HIF1ɑ reporter (Addgene, 46926 ; ) was subcloned into a lentiviral delivery plasmid using a Gibson assembly-based modular assembly platform (GMAP) ( ). .. The 5xHRE-GFP region and a Article Title: Complementary constraints in germ and immune cells shape evolution of gene regulation and phenotype Article Snippet: .. sgRNAs were designed to target the NGG sites nearest to and flanking the identified CTCF binding domain within the swapped human promoter sequence ( Table S6 ). sgRNAs were cloned into lentiCRISPR v2 plasmid with a Cas9 and Article Title: Targeting leucine-rich repeat kinase 2 overcomes resistance to oncolytic herpes simplex virus-based therapies in glioblastoma. Article Snippet: .. The gene encoding human NECTIN1 was synthesized by GENEWIZ and cloned into the LentiCRISPRv2GFP vector, which contains a Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the lentiCRISPR v2 backbone containing a Sequencing:Article Title: Mouse neural tube organoids self-organize floorplate through BMP-mediated cluster competition. Article Snippet: Primary antibodies used: rabbit anti-FOXA2 (Cell Signalling Technologies, #8186S, 1:1000), andmouse anti-ß-tubulin (MPI-CBG antibody facility, 1:200), HRPconjugated secondary antibodies used: Invitrogen Goat anti-Rabbit/Mouse 1:2000. .. H2A-mCherry was integrated into the Rosa26 safe harbour locus of FOXA2-Venus cell line.We first obtained aRosa26 targeting vector with Article Title: Clonal neural tube organoids self-organise floorplate through BMP-mediated cluster competition Article Snippet: .. We first obtained a Rosa26 targeting vector with Article Title: Complementary constraints in germ and immune cells shape evolution of gene regulation and phenotype Article Snippet: .. sgRNAs were designed to target the NGG sites nearest to and flanking the identified CTCF binding domain within the swapped human promoter sequence ( Table S6 ). sgRNAs were cloned into lentiCRISPR v2 plasmid with a Cas9 and Plasmid Preparation:Article Title: Clonal neural tube organoids self-organise floorplate through BMP-mediated cluster competition Article Snippet: .. We first obtained a Rosa26 targeting vector with Article Title: Identification of X-chromosomal genes that drive sex differences in embryonic stem cells through a hierarchical CRISPR screening approach. Article Snippet: Cells were selected with puromycin (1 ng/μl, Sigma) for 3 days, starting at day 2 after transfection. .. The Article Title: The MEMIC is an ex vivo system to model the complexity of the tumor microenvironment Article Snippet: To create a hypoxia reporter for live imaging, an existing GFP-based HIF1ɑ reporter (Addgene, 46926 ; ) was subcloned into a lentiviral delivery plasmid using a Gibson assembly-based modular assembly platform (GMAP) ( ). .. The 5xHRE-GFP region and a Article Title: Complementary constraints in germ and immune cells shape evolution of gene regulation and phenotype Article Snippet: .. sgRNAs were designed to target the NGG sites nearest to and flanking the identified CTCF binding domain within the swapped human promoter sequence ( Table S6 ). sgRNAs were cloned into lentiCRISPR v2 plasmid with a Cas9 and Article Title: Targeting leucine-rich repeat kinase 2 overcomes resistance to oncolytic herpes simplex virus-based therapies in glioblastoma. Article Snippet: .. The gene encoding human NECTIN1 was synthesized by GENEWIZ and cloned into the LentiCRISPRv2GFP vector, which contains a Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the lentiCRISPR v2 backbone containing a Transfection:Article Title: Identification of X-chromosomal genes that drive sex differences in embryonic stem cells through a hierarchical CRISPR screening approach. Article Snippet: Cells were selected with puromycin (1 ng/μl, Sigma) for 3 days, starting at day 2 after transfection. .. The Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the lentiCRISPR v2 backbone containing a Expressing:Article Title: Identification of X-chromosomal genes that drive sex differences in embryonic stem cells through a hierarchical CRISPR screening approach. Article Snippet: Cells were selected with puromycin (1 ng/μl, Sigma) for 3 days, starting at day 2 after transfection. .. The Amplification:Article Title: The MEMIC is an ex vivo system to model the complexity of the tumor microenvironment Article Snippet: To create a hypoxia reporter for live imaging, an existing GFP-based HIF1ɑ reporter (Addgene, 46926 ; ) was subcloned into a lentiviral delivery plasmid using a Gibson assembly-based modular assembly platform (GMAP) ( ). .. The 5xHRE-GFP region and a Cloning:Article Title: The MEMIC is an ex vivo system to model the complexity of the tumor microenvironment Article Snippet: To create a hypoxia reporter for live imaging, an existing GFP-based HIF1ɑ reporter (Addgene, 46926 ; ) was subcloned into a lentiviral delivery plasmid using a Gibson assembly-based modular assembly platform (GMAP) ( ). .. The 5xHRE-GFP region and a Binding Assay:Article Title: Complementary constraints in germ and immune cells shape evolution of gene regulation and phenotype Article Snippet: .. sgRNAs were designed to target the NGG sites nearest to and flanking the identified CTCF binding domain within the swapped human promoter sequence ( Table S6 ). sgRNAs were cloned into lentiCRISPR v2 plasmid with a Cas9 and Clone Assay:Article Title: Complementary constraints in germ and immune cells shape evolution of gene regulation and phenotype Article Snippet: .. sgRNAs were designed to target the NGG sites nearest to and flanking the identified CTCF binding domain within the swapped human promoter sequence ( Table S6 ). sgRNAs were cloned into lentiCRISPR v2 plasmid with a Cas9 and Article Title: Targeting leucine-rich repeat kinase 2 overcomes resistance to oncolytic herpes simplex virus-based therapies in glioblastoma. Article Snippet: .. The gene encoding human NECTIN1 was synthesized by GENEWIZ and cloned into the LentiCRISPRv2GFP vector, which contains a Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the lentiCRISPR v2 backbone containing a Synthesized:Article Title: Targeting leucine-rich repeat kinase 2 overcomes resistance to oncolytic herpes simplex virus-based therapies in glioblastoma. Article Snippet: .. The gene encoding human NECTIN1 was synthesized by GENEWIZ and cloned into the LentiCRISPRv2GFP vector, which contains a CRISPR:Article Title: Supporting Information for Liver cancer development driven by the AP-1/c-Jun~Fra-2 dimer through c- Myc Article Snippet: .. To delete the c-MYC (WRE) enhancer, two flanking CRISPR guides were designed (sg_1: GCCCCTTTGTGGCCTAGGGC and sg_2: GCCCTAGGCCACAAAGGGGC) and cloned into the lentiCRISPR v2 backbone containing a |